Locus MRUPAV PLIN4
Suggest EditDisease
–
Name Myopathy with Rimmed Ubiquitin-Positive Autophagic Vacuolation, PLIN4-Related Myopathy
Inheritance
Description Autosomal dominant myopathy with rimmed ubiquitin-positive autophagic vacuolation (MRUPAV) is characterized by adult onset of slowly progressive skeletal muscle weakness variably affecting the distal or proximal lower limbs. Some patients may also have upper limb involvement or neck muscle weakness, but respiratory and bulbar involvement only rarely occurs. EMG studies show a myopathic process, and myotonia may also be observed1 . An early characterisation of the disease was reported in Blasi, et al.2 .
HPO Terms
–
Association
Mendelian
Locus
Details This is an expanded variable number tandem repeat (VNTR) in the PLIN4 gene, located in exon 3. This repeat consists of a 99 bp motif which encodes 33 amino-acids within the perilipin-4 protein7 . Expansions of this 99 bp motif lead to insertion of multiple imperfect 33–amino acid repeats. These repetitive sequences are thought to contribute to abnormal protein aggregation and dysregulated autophagy seen in affected muscle tissue1 .
Mechanism The present disease is characterized by dominantly inherited progressively increasing mobilization of aggrephagy at sites of progressive accumulation of a mutated protein, suggesting that the mutation is leading to aggregation, likely through misfolding, exceeding aggrephagic capacity7
GoF
Detection
Short-read sequencing and exome sequencing are reported to not reliably detect this repeat. Long-range PCR is used for detection, while long-read sequencing is used to fully resolve size and structure [@pmid:32451610; @pmid:33811808].
Alleles
Ref. Motif Reference motif, reference orientation
TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC
Ranges
Benign (ref.) Benign motif, reference orientation
–
Benign (gene) Benign motif, gene orientation
–
Pathogenic (ref.) Pathogenic motif, reference orientation
TGGTGTCCACGCCGGTCTGGATGGTTCCTTTGGCCACATTCATGGCACCAGTCACCCCACTACAGACGGTGTCCTTGGTACCTGTTAGGACAGTCTTAC
Pathogenic (gene) Pathogenic motif, gene orientation
AAAGGAACCATCCAGACCGGCGTGGACACCAGTAAGACTGTCCTAACAGGTACCAAGGACACCGTCTGTAGTGGGGTGACTGGTGCCATGAATGTGGCC
Unknown (ref.) Unknown motif, reference orientation
–
Unknown (gene) Unknown motif, gene orientation
–
Interruption (ref.) Interruption motif, reference orientation
–
Interruption (gene) Interruption motif, gene orientation
–
References
Direct supporting references for info on this page.
2
Abnormal lysosomal and ubiquitin-proteasome pathways in 19p13.3 distal myopathy.
Claudia,Di Blasi, Behzad,Moghadaszadeh, Claudia,Ciano, Tiziana,Negri, Alessio,Giavazzi, Ferdinando,Cornelio, Lucia,Morandi, Marina,Mora
Annals of neurology · 2004-07-01
pmid:152364123
Subsarcolemmal and cytoplasmic p62 positivity and rimmed vacuoles are distinctive for PLIN4-myopathy.
Qi,Wang, Meng,Yu, Wei,Zhang, Qiang,Gang, Zhiying,Xie, Jin,Xu, Chao,Zhou, Depeng,Wang, Lingchao,Meng, He,Lv, Zhirong,Jia, Jianwen,Deng, Yun,Yuan, Zhaoxia,Wang
Annals of clinical and translational neurology · 2022-09-24
pmid:361518494
Repeat Expansions in PLIN4 Cause Autosomal Dominant Vacuolar Myopathy With Sarcolemmal Features.
Laura,Llansó, Igor,Stevanovski, Germán,Morís, Roger,Collet-Vidiella, Alba,Segarra-Casas, Lidia,González-Quereda, Benjamín,Rodríguez-Santiago, Pia,Gallano, Rodrigo,Alvarez, Ana,Vesperinas, Rosa,Blanco, Beatriz,San-Millán, Carmen,Navarro, Isabel,Illa, Gianina,Ravenscroft, Ira W,Deveson, Eduard,Gallardo, Montse,Olivé
Annals of clinical and translational neurology · 2025-07-22
pmid:406935625
PLIN4-related myopathy: clinical, histological and imaging data in a large cohort of patients.
Lorenzo,Maggi, Sara,Gibertini, Eliana,Iannibelli, Annamaria,Gallone, Silvia,Bonanno, Daniele,Cazzato, Simonetta,Gerevini, Marco,Moscatelli, Flavia,Blasevich, Giorgia,Riolo, Renato,Mantegazza, Alessandra,Ruggieri
Journal of neurology · 2023-05-05
pmid:371451566
Expanding the phenotype and genotype spectra of PLIN4-associated myopathy with rimmed ubiquitin-positive autophagic vacuolation.
Kang,Yang, Yi-Heng,Zeng, Yu-Sen,Qiu, Feng,Lin, Hai-Zhu,Chen, Ming,Jin, Long,Chen, Fu-Ze,Zheng, Yuan-Liang,Ding, Chun-Yan,Cao, Min-Ting,Lin, Wan-Jin,Chen, Zhi-Qiang,Wang, Ning,Wang
Acta neuropathologica · 2022-05-02
pmid:354997797
Multiomic elucidation of a coding 99-mer repeat-expansion skeletal muscle disease.
Alessandra,Ruggieri, Sergey,Naumenko, Martin A,Smith, Eliana,Iannibelli, Flavia,Blasevich, Cinzia,Bragato, Sara,Gibertini, Kirston,Barton, Matthias,Vorgerd, Katrin,Marcus, Peixiang,Wang, Lorenzo,Maggi, Renato,Mantegazza, James J,Dowling, Rudolf A,Kley, Marina,Mora, Berge A,Minassian
Acta neuropathologica · 2020-05-25
pmid:32451610Additional Literature
Additional literature related to this locus.
Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem
repeats, and disease, in medline format)
dmTGS: Precise Targeted Enrichment Long-Read Sequencing Panel for Tandem Repeat Detection.
Kang,Yang, Yue,Liu, Ji,Zhang, Qian,Yu, Feng,Xu, Jiyuan,Liu, Yuting,Li, Xiaojie,Zhang, Zhiqiang,Wang, Ning,Wang, Yuezhen,Li, Yan,Shi, Wan-Jin,Chen
Clinical chemistry · 2025-02-03
pmid:39492694