Locus ADTKD MUC1

An inherited disorder that causes a gradual loss of kidney function, caused by a mutation in the MUC1 gene that leads to production of an abnormal mucin 1 protein, which deposits in the kidney and leads to slow loss of kidney function¹.

Prevalence

2.5 1,000,000

Disease is affected 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsible for 95% of disease²

Age of Onset

Age of onset for end-stage renal disease (the only systemic manifestation) ranges from 16³-70².

HPO Terms

–

Association

Mendelian

Locus

hg19 chr1:155160981-155162030

hg38 chr1:155188505-155192239

t2t chr1:154328121-154330802

Details

Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract (i.e. from (C)7 to (C)8) within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family⁴. NOTE: Disease is caused by a 7 to 8 C homopolymer expansion within the main motif which we represent here as a change in motif.

Mechanism

GoF

Toxic protein product accumulates in kidneys²

Detection

This locus is particularly difficult to genotype [@pmid:23396133; @pmid:39781475]. Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40–83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant [@pmid:41285770]. Exome sequencing, short-read sequencing, and Sanger sequencing do not reliably detect these variants [@genereviews:NBK153723]. Instead, they are commonly detected by a VNTR assay, or resolved with long-read sequencing [@genereviews:NBK153723; @pmid:29520014].

Year

2013⁵

Location in Gene

Coding Exon 2

Gene Strand

Alleles

Ref. Motif

GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG

Ranges

Benign (ref.)

GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCA

Benign (gene)

ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG

Pathogenic (ref.)

GCCCACGGTGTCACCTCGGCCCCGGACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCA

Pathogenic (gene)

ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG

Unknown (ref.)

–

Unknown (gene)

–

Interruption (ref.)

–

Interruption (gene)

–

References

Direct supporting references for info on this page.

Ontology Lookup Service (OLS)

mondo:0020726

Autosomal Dominant Tubulointerstitial Kidney Disease – MUC1

Anthony J.,Bleyer, Martina,Živná, Kendrah,Kidd, Stanislav,Kmoch

GeneReviews® · 1993-01-01

genereviews:NBK153723

Long-Read Sequencing of the

Alena,Vrbacká, Anna,Přistoupilová, Kendrah O,Kidd, Václav,Janoušek, Martin,Radina, Petr,Vyleťal, Ibrahim,Bitar, Viktor,Stránecký, Lenka,Steiner-Mrázová, Helena,Trešlová, Jana,Sovová, Kateřina,Hodaňová, Hana,Hartmannová, Dita,Mušálková, Klára,Svojšová, Tereza,Kmochová, Veronika,Barešová, Abby,Taylor, Lauren,Martin, Antonio,Sanchez, Romana,Ryšavá, Innet,Lajtmanová, Silvie,Rajnochová-Bloudíčková, Ondřej,Viklický, Gregorius,Papagregorius, Constantinos,Deltas, Christoforos,Stavrou, Sofia,Jorge, José António,Lopes, Márcia,Rodrigues, Elhussein,Elhassan, Michelle,Clince, Colm,Rowan, Peter,Conlon, Omri,Teltsh, Gianpiero L,Cavalleri, Brendan,Blumenstiel, Diana,Toledo, Marina,DiStefano, Matthew,DeFelice, Martina,Živná, Anthony J,Bleyer, Stanislav,Kmoch

bioRxiv : the preprint server for biology · 2025-09-16

pmid:41000883

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

Mutations causing medullary cystic kidney disease type 1 lie in a large VNTR in MUC1 missed by massively parallel sequencing.

Andrew,Kirby, Andreas,Gnirke, David B,Jaffe, Veronika,Barešová, Nathalie,Pochet, Brendan,Blumenstiel, Chun,Ye, Daniel,Aird, Christine,Stevens, James T,Robinson, Moran N,Cabili, Irit,Gat-Viks, Edward,Kelliher, Riza,Daza, Matthew,DeFelice, Helena,Hůlková, Jana,Sovová, Petr,Vylet'al, Corinne,Antignac, Mitchell,Guttman, Robert E,Handsaker, Danielle,Perrin, Scott,Steelman, Snaevar,Sigurdsson, Steven J,Scheinman, Carrie,Sougnez, Kristian,Cibulskis, Melissa,Parkin, Todd,Green, Elizabeth,Rossin, Michael C,Zody, Ramnik J,Xavier, Martin R,Pollak, Seth L,Alper, Kerstin,Lindblad-Toh, Stacey,Gabriel, P Suzanne,Hart, Aviv,Regev, Chad,Nusbaum, Stanislav,Kmoch, Anthony J,Bleyer, Eric S,Lander, Mark J,Daly

Nature genetics · 2013-02-10

pmid:23396133

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Single-Molecule Real-Time Sequencing for MUC1 VNTR Variation to Improve Autosomal Dominant Tubulointerstitial Kidney Disease Diagnosis.

Alena,Vrbacká, Anna,Přistoupilová, Kendrah O,Kidd, Václav,Janoušek, Martin,Radina, Petr,Vyleťal, Ibrahim,Bitar, Viktor,Stránecký, Lenka,Steiner-Mrázová, Helena,Trešlová, Jana,Sovová, Kateřina,Hodaňová, Hana,Hartmannová, Dita,Mušálková, Klára,Svojšová, Tereza,Kmochová, Veronika,Barešová, Heidi,Bleyer, Abby,Taylor, Lauren,Martin, Antonio,Sanchez, Romana,Ryšavá, Innet,Lajtmanová, Silvie,Rajnochová-Bloudíčková, Ondřej,Viklický, Gregory,Papagregoriou, Constantinos,Deltas, Christoforos,Stavrou, Sofia,Jorge, José António,Lopes, Márcia,Rodrigues, Elhussein,Elhassan, Michelle,Clince, Colm,Rowan, Peter,Conlon, Omri,Teltsh, Gianpiero L,Cavalleri, Brendan,Blumenstiel, Diana,Toledo, Marina,DiStefano, Matthew,DeFelice, Martina,Živná, Anthony J,Bleyer, Stanislav,Kmoch

Journal of the American Society of Nephrology : JASN · 2026-04-10

pmid:41961547

Inhibition of endocytosis by glycans arises from steric rather than electrostatic repulsion.

Advika,Kamatar, Jose A,Villalobos, Carl C,Hayden, Fabiola G,Rodriguez Flores, Stephanie,Archer-Hartmann, Parastoo,Azadi, Brian,Belardi, Sapun H,Parekh, Jeanne C,Stachowiak

Biophysical journal · 2026-03-13

pmid:41832605

Analysis of clinically relevant large tandem repeats using nanopore sequencing.

Silvia,Madritsch, David,Horner, Tamara,Löwenstern, Nadja,Brait, Vivienne,Arnold, Andrea,Wenzel, Denisa,Weis, Markus,Hengstschläger, Franco,Laccone

Scientific reports · 2025-12-04

pmid:41345522

Clinical use of the VNtyper-Kestrel pipeline for MUC1 variant detection in autosomal-dominant tubulointerstitial kidney disease.

China,Nagano, Naoya,Morisada, Yuta,Inoki, Yu,Tanaka, Yuta,Ichikawa, Chika,Ueda, Hideaki,Kitakado, Yuya,Aoto, Nana,Sakakibara, Tomoko,Horinouchi, Tomohiko,Yamamura, Shingo,Ishimori, Kandai,Nozu

Clinical and experimental nephrology · 2025-04-17

pmid:40244446

Phenotypic Heterogeneity of ADTKD-MUC1 Diagnosed Using VNtyper, a Novel Genetic Technique.

Jessica,Kachmar, Hassan,Saei, Vincent,Morinière, Laurence,Heidet, Bertrand,Knebelmann, Olivier,Gribouval, Manon,Mautret-Godefroy, Stéphane,Burtey, Vincent,Vuiblet, Asma,Alla, Axel,Ibalanky, Olivier,Moranne, Mathilde,Nizon, Benjamin,Savenkoff, Patrick,Nitschké, Corinne,Antignac, Guillaume,Dorval

American journal of kidney diseases : the official journal of the National Kidney Foundation · 2025-01-22

pmid:39848530

Unraveling

Amanda,Helms, Vincent,Chang, Stacy A,Malaker, Jennifer S,Brodbelt

Analytical chemistry · 2024-11-22

pmid:39576755

Systematic Screening of Autosomal Dominant Tubulointerstitial Kidney Disease- MUC1 27dupC Pathogenic Variant through Exome Sequencing.

Ilias,Bensouna, Thomas,Robert, Xavier,Vanhoye, Marine,Dancer, Laure,Raymond, Pierre,Delaugère, Pascale,Hilbert, Hugues,Richard, Laurent,Mesnard

Journal of the American Society of Nephrology : JASN · 2024-09-26

pmid:39325540

Erik P,Lillehoj, Yafan,Yu, Avelino C,Verceles, Akihiro,Imamura, Hideharu,Ishida, Kurt H,Piepenbrink, Simeon E,Goldblum

iScience · 2024-08-31

pmid:39314239

Analysis of Molecular Genetic Variants of Lgals4 in Esophageal Cancer: A Preliminary Report.

Surmeet,Kaur, Rajiv,Devgan, Jagdeep,Singh, Namarta,Kalia, Jatinder,Singh, Manpreet,Kaur

Biochemical genetics · 2024-04-12

pmid:38605207