Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts¹. Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions². In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype³. Comorbidity has been proposed between MODY and fecal elastase deficiency (FED)⁴.

Prevalence

Found in individuals of Danish and Norwegian ancestry^5,6.

Age of Onset

11-17⁶

HPO Terms

–

Association

Mendelian

Locus

hg19 chr9:135946564-135947124

hg38 chr9:133071177-133071737

t2t chr9:145285333-145285861

Details

The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 5³. One reported proximal VNTR deletion is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Distal CEL VNTR single-base insertions, particularly INS9/INS10/INS12, have been reported as likely benign polymorphisms, while proximal insertion variants may have greater pathogenic potential⁷. Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse⁶. Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs)⁸. Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.

Mechanism

GoF

Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is largely preserved^9,10,11. Functional testing of CEL VNTR insertion variants showed that proximal insertions had greater aggregation and UPR effects⁷.

Detection

Year

2005

Location in Gene

Exon 11

Gene Strand

Alleles

Ref. Motif

GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG

Ranges

Benign (ref.)

–

Benign (gene)

–

Pathogenic (ref.)

GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG

Pathogenic (gene)

ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC

Unknown (ref.)

–

Unknown (gene)

–

Interruption (ref.)

–

Interruption (gene)

–

References

Direct supporting references for info on this page.

1omim:609812

2genereviews:NBK500456

Two New Mutations in the CEL Gene Causing Diabetes and Hereditary Pancreatitis: How to Correctly Identify MODY8 Cases.

Khadija,El Jellas, Petra,Dušátková, Ingfrid S,Haldorsen, Janne,Molnes, Erling,Tjora, Bente B,Johansson, Karianne,Fjeld, Stefan,Johansson, Štěpánka,Průhová, Leif,Groop, J Matthias,Löhr, Pål R,Njølstad, Anders,Molven

The Journal of clinical endocrinology and metabolism · 2022-03-24

pmid:34850019

4pmid:18544793

Mutations in the CEL VNTR cause a syndrome of diabetes and pancreatic exocrine dysfunction.

Helge,Raeder, Stefan,Johansson, Pål I,Holm, Ingfrid S,Haldorsen, Eric,Mas, Véronique,Sbarra, Ingrid,Nermoen, Stig A,Eide, Louise,Grevle, Lise,Bjørkhaug, Jørn V,Sagen, Lage,Aksnes, Oddmund,Søvik, Dominique,Lombardo, Anders,Molven, Pål Rasmus,Njølstad

Nature genetics · 2005-12-20

pmid:16369531

Mutations in the VNTR of the carboxyl-ester lipase gene (CEL) are a rare cause of monogenic diabetes.

Janniche,Torsvik, Stefan,Johansson, Anders,Johansen, Jakob,Ek, Jayne,Minton, Helge,Raeder, Sian,Ellard, Andrew,Hattersley, Oluf,Pedersen, Torben,Hansen, Anders,Molven, Pål R,Njølstad

Human genetics · 2009-09-17

pmid:19760265

Common single-base insertions in the VNTR of the carboxyl ester lipase (CEL) gene are benign and also likely to arise somatically in the exocrine pancreas.

Ranveig S,Brekke, Anny,Gravdal, Khadija,El Jellas, Grace E,Curry, Jianguo,Lin, Steven J,Wilhelm, Solrun J,Steine, Eric,Mas, Stefan,Johansson, Mark E,Lowe, Bente B,Johansson, Xunjun,Xiao, Karianne,Fjeld, Anders,Molven

Human molecular genetics · 2024-05-18

pmid:38483348

Unraveling the genetic basis of MODY: insights from next-generation sequencing.

Metin,Eser, Gulam,Hekimoglu, Fatma,Dursun

Journal of applied genetics · 2024-10-03

pmid:39361122

Diabetes and pancreatic exocrine dysfunction due to mutations in the carboxyl ester lipase gene-maturity onset diabetes of the young (CEL-MODY): a protein misfolding disease.

Bente B,Johansson, Janniche,Torsvik, Lise,Bjørkhaug, Mette,Vesterhus, Anja,Ragvin, Erling,Tjora, Karianne,Fjeld, Dag,Hoem, Stefan,Johansson, Helge,Ræder, Susanne,Lindquist, Olle,Hernell, Miriam,Cnop, Jaakko,Saraste, Torgeir,Flatmark, Anders,Molven, Pål R,Njølstad

The Journal of biological chemistry · 2011-07-22

pmid:21784842

A Carboxyl Ester Lipase (CEL) Mutant Causes Chronic Pancreatitis by Forming Intracellular Aggregates That Activate Apoptosis.

Xunjun,Xiao, Gabrielle,Jones, Wednesday A,Sevilla, Donna B,Stolz, Kelsey E,Magee, Margaret,Haughney, Amitava,Mukherjee, Yan,Wang, Mark E,Lowe

The Journal of biological chemistry · 2016-09-20

pmid:27650499

The position of single-base deletions in the VNTR sequence of the carboxyl ester lipase (CEL) gene determines proteotoxicity.

Anny,Gravdal, Xunjun,Xiao, Miriam,Cnop, Khadija,El Jellas, Stefan,Johansson, Pål R,Njølstad, Mark E,Lowe, Bente B,Johansson, Anders,Molven, Karianne,Fjeld

The Journal of biological chemistry · 2021-04-14

pmid:33862081

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Dexamethasone prophylaxis for excessive lymphocyte expansion after cilta-cel in multiple myeloma.

Peter A,Forsberg, Jacqueline A,Turner, Marita,Meyer, Diana,Abbott, Sara,Nicholson, Henning,Schade, Jeffrey,Matous, Tara,Gregory

Blood advances · 2026-05-26

pmid:41894686

Routine Monitoring of CAR-T-Cells Expansion and Persistence in Patients With Aggressive Large B-Cell Lymphoma by Flow Cytometry: A Single-Center Experience.

Alexandra,Zduniak, Jérémie,Martinet, Emilie,Lévêque, Stéphanie,Becker, David,Tonnelet, Elodie Dos,Santos, Claire,Leroy, Mustafa,Alani, Jean,Rouvet, Marine,Brousseau, Camille,Giverne, Alexis,Cuffel, Serge,Jacquot, Arnaud,Roucheux, Alice,Veuiller, Nicolas,Lecornu, Misa Eugene,Norbert, Olivier,Boyer, Hervé,Tilly, Fabrice,Jardin, Jean-Baptiste,Latouche, Vincent,Camus

Hematological oncology · 2025-11-01

pmid:41057236

Early-onset diabetes with low utilization of lipid as an energy source carrying a rare missense mutation in the CEL gene.

Ayana,Fujii, Hiroko,Nakabayashi, Yuko,Nagao, Masaru,Akiyama, Akihiko,Taguchi, Kaito,Yorimoto, Risako,Hamada, Issei,Saeki, Naoki,Yamamoto, Taro,Takami, Kenji,Watanabe, Yoichi,Mizukami, Yasuharu,Ohta

Endocrinology, diabetes & metabolism case reports · 2025-08-18

pmid:40840513

Characterizing Cellular Expansion of Idecabtagene Vicleucel and Association with Clinical Efficacy and Safety in Patients with Triple-Class-Exposed Relapsed/Refractory Multiple Myeloma.

Fan,Wu, Xirong,Zheng, Joseph,Burnett, Madhan,Masilamani, Wanying,Zhang, Xiaobo,Zhong, Andrea,Caia, Mark,Cook, Julia,Piasecki, Anna,Kondic, Manisha,Lamba, Jian,Zhou

Journal of clinical pharmacology · 2025-07-10

pmid:40641008

Brexucabtagene autoleucel in-vivo expansion and BTKi refractoriness have a negative influence on progression-free survival in mantle cell lymphoma: Results from CART-SIE study.

Federico,Stella, Annalisa,Chiappella, Martina,Magni, Francesca,Bonifazi, Chiara,De Philippis, Maurizio,Musso, Ilaria,Cutini, Silva,Ljevar, Anna Maria,Barbui, Mirko,Farina, Massimo,Martino, Massimo,Massaia, Giovanni,Grillo, Piera,Angelillo, Barbara,Botto, Francesca,Patriarca, Mauro,Krampera, Luca,Arcaini, Maria Chiara,Tisi, Pierluigi,Zinzani, Federica,Sorà, Stefania,Bramanti, Martina,Pennisi, Cristiana,Carniti, Paolo,Corradini

British journal of haematology · 2024-12-22

pmid:39710966

Common single-base insertions in the VNTR of the carboxyl ester lipase (CEL) gene are benign and also likely to arise somatically in the exocrine pancreas.

Human molecular genetics · 2024-05-18

pmid:38483348

Unlocking Predictive Power: Quantitative Assessment of CAR-T Expansion with Digital Droplet Polymerase Chain Reaction (ddPCR).

Eugenio,Galli, Marcello,Viscovo, Federica,Fosso, Ilaria,Pansini, Giacomo,Di Cesare, Camilla,Iacovelli, Elena,Maiolo, Federica,Sorà, Stefan,Hohaus, Simona,Sica, Silvia,Bellesi, Patrizia,Chiusolo

International journal of molecular sciences · 2024-02-26

pmid:38473919

Early Chimeric Antigen Receptor T Cell Expansion Is Associated with Prolonged Progression-Free Survival for Patients with Relapsed/Refractory Multiple Myeloma Treated with Ide-Cel: A Retrospective Monocentric Study.

Leo,Caillot, Emmanuel,Sleiman, Ingrid,Lafon, Marie-Lorraine,Chretien, Pauline,Gueneau, Alexandre,Payssot, Romain,Pedri, Daniela,Lakomy, François,Bailly, Julien,Guy, Jean-Pierre,Quenot, Herve,Avet-Loiseau, Denis,Caillot

Transplantation and cellular therapy · 2024-03-07

pmid:38458477

The genetic risk factor CEL-HYB1 causes proteotoxicity and chronic pancreatitis in mice.

Karianne,Fjeld, Anny,Gravdal, Ranveig S,Brekke, Jahedul,Alam, Steven J,Wilhelm, Khadija,El Jellas, Helene N,Pettersen, Jianguo,Lin, Marie H,Solheim, Solrun J,Steine, Bente B,Johansson, Pål R,Njølstad, Caroline S,Verbeke, Xunjun,Xiao, Mark E,Lowe, Anders,Molven

Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.] · 2022-11-09

pmid:36379850

Locus MODY8 CEL

Disease

Locus

Alleles

References

Additional Literature